Cryptic proteins translated from deletion-containing viral genomes dramatically expand the influenza virus proteome.

Productive infections by RNA viruses require faithful replication of the entire genome. Yet many RNA viruses also produce deletion-containing viral genomes (DelVGs), aberrant replication products with large internal deletions. DelVGs interfere with the replication of wild-type virus and their presence in patients is associated with better clinical outcomes. The DelVG RNA itself is hypothesized to confer this interfering activity. DelVGs antagonize replication by out-competing the full-length genome and triggering innate immune responses. Here, we identify an additionally inhibitory mechanism mediated by a new class of viral proteins encoded by DelVGs. We identified hundreds of cryptic viral proteins translated from DelVGs. These DelVG-encoded proteins (DPRs) include canonical viral proteins with large internal deletions, as well as proteins with novel C-termini translated from alternative reading frames. Many DPRs retain functional domains shared with their full-length counterparts, suggesting they may have activity during infection. Mechanistic studies of DPRs derived from the influenza virus protein PB2 showed that they poison replication of wild-type virus by acting as dominant-negative inhibitors of the viral polymerase. These findings reveal that DelVGs have a dual inhibitory mechanism, acting at both the RNA and protein level. They further show that DPRs have the potential to dramatically expand the functional proteomes of diverse RNA viruses.

A Novel Homozygous Deletion Including Exon 1 of FA2H Gene Causes Spastic Paraplegia-35: Genetic and Lipidomics Analysis of the Patients.

BACKGROUND: Fatty acid 2-hydroxylase (FA2H) is encoded by the FA2H gene, with mutations therein leading to the neurodegenerative condition, spastic paraplegia-35 (SPG35). We aim to elucidate the genetic underpinnings of a nonconsanguineous Chinese family diagnosed with SPG35 by examining the clinical manifestations, scrutinizing genetic variants, and establishing the role of FA2H mutation in lipid metabolism. METHODS: Using next-generation sequencing analysis to identify the pathogenic gene in this pedigree and family cosegregation verification. The use of lipidomics of patient pedigree peripheral blood mononuclear cells further substantiated alterations in lipid metabolism attributable to the FA2H exon 1 deletion. RESULTS: The proband exhibited gait disturbance from age 5 years; he developed further clinical manifestations such as scissor gait and dystonia. His younger sister also presented with a spastic gait from the same age. We identified a homozygous deletion in the region of FA2H exon 1, spanning from chr16:74807867 to chr16: 74810391 in the patients. Lipidomic analysis revealed significant differences in 102 metabolites compared with healthy controls, with 62 metabolites increased and 40 metabolites decreased. We specifically zeroed in on 19 different sphingolipid metabolites, which comprised ceramides, ganglioside, etc., with only three of these sphingolipids previously reported. CONCLUSIONS: This is the first study of lipid metabolism in the blood of patients with SPG35. The results broaden our understanding of the SPG35 gene spectrum, offering insights for future molecular mechanism research and laying groundwork for determining metabolic markers.

Homozygous deletion of the DSG3 terminal exon associated with acantholytic blistering of the oral and laryngeal mucosa.

We report a novel homozygous 49.6 kb deletion of chromosome 18q12.1 involving the last exon of DSG3 in dizygotic twins with phenotype consistent with acantholytic blistering of the oral and laryngeal mucosa (ABOLM). The twin siblings presented predominantly with friability of the laryngeal and respiratory mucosa. This is only the second report in the literature of this unusual autosomal recessive blistering disorder. The diagnosis explains the mucosal phenotype of a pemphigus-like disorder without evidence of autoimmune dysfunction. The exclusion of an autoimmune basis has management implications. The deletion also involved the DSG2 gene, which is associated with arrhythmogenic right ventricular dysplasia (ARVD). The affected siblings and heterozygous parents do not show any cardiac phenotype at this time. Functional studies would further clarify how deletions resulting in loss of function of DSG3 may cause the reported phenotypes of DSG3-related ABOLM.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Correlation between the insertion-deletion variant of the angiotensin-converting enzyme gene and various classes of heart failure.

The angiotensin-converting enzyme (ACE) genetic variation for insertion/deletion (I/D) is located at the 16th intron of the ACE gene. A number of studies investigated the homozygous deletion genotype of ACE and its association with cardiovascular diseases. However, ACE's genetic variation and its association with heart failure (HF) is yet to be confirmed. We examined the possibility of the association between the ACE I/D gene variant with the severity of HF. The ACE genotypes were determined by polymerase chain reactions using samples derived from 150 patients with HF and 90 healthy subjects which were age and gender-matched. These patients included those of all four of the New York Heart Association (NYHA) classes. Echocardiography was performed on all HF patients and ejection fraction (EF), left ventricular systolic and diastolic diameters were measured. The HF patients were redistributed to systolic where EF is equal and less than 45% and non-systolic HF where EF is more than 45%. We demonstrate a statistically significant difference in DD genotype in NYHA class IV in comparison to the control group. The values of odds ratio (OR) (95%CI) of the DD genotype (DD vs ID and II) were 3.37 (1.01-11.19) (p value = 0.039) and the OR (95%CI) of the D allele (D vs I) was 2.55 (0.98-6.65) (p value = 0.049). Higher frequencies of D allele compared to I allele is linked to severity of HF. DD variant of the ACE gene is associated with NYHA class IV heart failure. This could have a profound impact on risk stratification and prognosis of HF in the management of this condition.

A Putative Zn(II)2Cys6-Type Transcription Factor FpUme18 Is Required for Development, Conidiation, Cell Wall Integrity, Endocytosis and Full Virulence in Fusarium pseudograminearum.

Fusarium pseudograminearum is one of the major fungal pathogens that cause Fusarium crown rot (FCR) worldwide and can lead to a substantially reduced grain yield and quality. Transcription factors play an important role in regulating growth and pathogenicity in plant pathogens. In this study, we identified a putative Zn(II)2Cys6 fungal-type domain-containing transcription factor and named it FpUme18. The expression of FpUME18 was induced during the infection of wheat by F. pseudograminearum. The ΔFpume18 deletion mutant showed defects in growth, conidial production, and conidial germination. In the responses to the cell wall, salt and oxidative stresses, the ΔFpume18 mutant inhibited the rate of mycelial growth at a higher rate compared with the wild type. The staining of conidia and mycelia with lipophilic dye FM4-64 revealed a delay in endocytosis when FpUME18 was deleted. FpUME18 also positively regulated the expression of phospholipid-related synthesis genes. The deletion of FpUME18 attenuated the pathogenicity of wheat coleoptiles. FpUME18 also participated in the production of the DON toxin by regulating the expression of TRI genes. Collectively, FpUme18 is required for vegetative growth, conidiation, stress response, endocytosis, and full virulence in F. pseudograminearum.

Novel homozygous LAMB1 in-frame deletion in a pediatric patient with brain anomalies and cerebrovascular event.

Biallelic pathogenic variants in LAMB1 have been associated with autosomal recessive lissencephaly 5 (OMIM 615191), which is characterized by brain malformations (cobblestone lissencephaly, hydrocephalus), developmental delay, and epilepsy. Pathogenic variants in LAMB1 are rare, with only 11 pathogenic variants and 11 patients reported to date. Here, we report on a 6-year-old patient from a consanguineous family with profound developmental delay, microcephaly, and a history of a perinatal cerebrovascular event. Brain magnetic resonance imaging (MRI) showed cerebellar cystic defects, signal intensity abnormalities, and a hypoplastic corpus callosum. Trio-exome analysis revealed a homozygous in-frame deletion of Exons 23 and 24 of LAMB1 affecting 104 amino acids including the epidermal growth factor (EGF)-like units 11 and 12 in Domain III. To our knowledge, this is the first reported in-frame deletion in LAMB1. Our findings broaden the clinical and molecular spectrum of LAMB1-associated syndromes.

Whole-genome and Epigenomic Landscapes of Malignant Gastrointestinal Stromal Tumors Harboring KIT Exon 11 557-558 Deletion Mutations.

Gastrointestinal stromal tumors (GIST) with KIT exon 11 deletions involving in codons 557-558 (KIT Δ557-558) exhibit higher proliferation rates and shorter disease-free survival times compared with GISTs with other KIT exon 11 mutations. We analyzed 30 GIST cases and observed genomic instability and global DNA hypomethylation only in high-risk malignant GISTs with KIT Δ557-558. Whole-genome sequencing revealed that the high-risk malignant GISTs with KIT Δ557-558 (12 cases) had more structural variations (SV), single-nucleotide variants, and insertions and deletions compared with the low-risk, less malignant GISTs with KIT Δ557-558 (six cases) and the high-risk (six cases) or low-risk (6 cases) GISTs with other KIT exon 11 mutations. The malignant GISTs with KIT Δ557-558 showed higher frequency and significance in copy number (CN) reduction on chromosome arms 9p and 22q, and 50% of them had LOH or CN-dependent expression reduction in CDKN2A. In addition, SVs with driver potential were detected in 75% of them, in which AKT3 and MGMT were recurrently identified. Genome-wide DNA methylation and gene expression analyses showed global intergenic DNA hypomethylation, SNAI2 upregulation, and higher expression signatures, including p53 inactivation and chromosomal instability, as characteristics of malignant GISTs with KIT Δ557-558 that distinguished them from other GISTs. These genomic and epigenomic profiling results revealed that KIT Δ557-558 mutations are associated with increased genomic instability in malignant GISTs. Significance: We present genomic and epigenomic insights into the malignant progression of GISTs with KIT exon 11 deletions involving in 557-558, demonstrating their unique chromosomal instability and global intergenic DNA hypomethylation.

Nanopore sequencing identifies a higher frequency and expanded spectrum of mitochondrial DNA deletion mutations in human aging.

Mitochondrial DNA (mtDNA) deletion mutations cause many human diseases and are linked to age-induced mitochondrial dysfunction. Mapping the mutation spectrum and quantifying mtDNA deletion mutation frequency is challenging with next-generation sequencing methods. We hypothesized that long-read sequencing of human mtDNA across the lifespan would detect a broader spectrum of mtDNA rearrangements and provide a more accurate measurement of their frequency. We employed nanopore Cas9-targeted sequencing (nCATS) to map and quantitate mtDNA deletion mutations and develop analyses that are fit-for-purpose. We analyzed total DNA from vastus lateralis muscle in 15 males ranging from 20 to 81 years of age and substantia nigra from three 20-year-old and three 79-year-old men. We found that mtDNA deletion mutations detected by nCATS increased exponentially with age and mapped to a wider region of the mitochondrial genome than previously reported. Using simulated data, we observed that large deletions are often reported as chimeric alignments. To address this, we developed two algorithms for deletion identification which yield consistent deletion mapping and identify both previously reported and novel mtDNA deletion breakpoints. The identified mtDNA deletion frequency measured by nCATS correlates strongly with chronological age and predicts the deletion frequency as measured by digital PCR approaches. In substantia nigra, we observed a similar frequency of age-related mtDNA deletions to those observed in muscle samples, but noted a distinct spectrum of deletion breakpoints. NCATS-mtDNA sequencing allows the identification of mtDNA deletions on a single-molecule level, characterizing the strong relationship between mtDNA deletion frequency and chronological aging.

Autosomal recessive congenital cataract is associated with a novel 4-bp splicing deletion mutation in a novel C10orf71 human gene.

Congenital cataract is one of the most genetically heterogeneous ocular conditions with different genes involved in its etiology. Here, we describe the analysis of a new candidate gene of a congenital bilateral cataract associated with polymalformative syndrome, moderate global developmental delay, microcephaly, axial hypotonia, intrauterine growth restriction and facial dysmorphism for two affected siblings. Molecular analysis included exome sequencing and genome wide homozygosity mapping revealed a region of homozygosity shared by the two affected siblings at 10q11.23. The new C10orf71 gene was included in this interval and direct sequencing of this gene revealed an already described homozygous c. 2123T > G mutation (p. L708R) for the two affected subjects. Interestingly, we revealed in contrast a 4-bp deletion on the 3'-splicing acceptor site of intron 3-exon 4, namely defined as IVS3-5delGCAA. The C10Orf71 gene expression analysis using RT-PCR showed an expression pattern in different fetal organs and tissues as well as in leukocytes and confirmed that the IVS3-5delGCAA deletion of the C10orf71 gene is a splicing mutation responsible for the shortening of the C10orf71 protein in the two related patients. The C10orf71 gene has not been described to date as associated to the autosomal recessive phenotype.

Characterization of AR-CGD female patient with a novel homozygous deletion in CYBC1 gene presenting with unusual clinical phenotype.

Chronic granulomatous disease (CGD) is a human IEI caused by mutations in genes encoding the NADPH oxidase subunits, the enzyme responsible for the respiratory burst. CGD patients have severe life-threatening infections, hyperinflammation and immune dysregulation. Recently, an additional autosomal recessive AR-CGD (type 5) caused by mutations in CYBC1/EROS gene was identified. We report a AR-CGD5 patient with a novel loss of function (LOF) homozygous deletion c.8_7del in the CYBC1 gene including the initiation ATG codon that leads to failure of CYBC1/EROS protein expression and presenting with an unusual clinical manifestation of childhood-onset sarcoidosis-like disease requiring multiple immunosuppressive therapies. We described an abnormal gp91phox protein expression/function in the patient's neutrophils and monocytes (about 50%) and a severely compromised B cell subset (gp91phox < 15%; DHR+ < 4%). Our case-report emphasized the importance of considering a diagnosis of AR-CGD5 deficiency even in absence of typical clinical and laboratory findings.

Deletion of the s2m RNA Structure in the Avian Coronavirus Infectious Bronchitis Virus and Human Astrovirus Results in Sequence Insertions.

Coronaviruses infect a wide variety of host species, resulting in a range of diseases in both humans and animals. The coronavirus genome consists of a large positive-sense single-stranded molecule of RNA containing many RNA structures. One structure, denoted s2m and consisting of 41 nucleotides, is located within the 3' untranslated region (3' UTR) and is shared between some coronavirus species, including infectious bronchitis virus (IBV), severe acute respiratory syndrome coronavirus (SARS-CoV), and SARS-CoV-2, as well as other pathogens, including human astrovirus. Using a reverse genetic system to generate recombinant viruses, we investigated the requirement of the s2m structure in the replication of IBV, a globally distributed economically important Gammacoronavirus that infects poultry causing respiratory disease. Deletion of three nucleotides predicted to destabilize the canonical structure of the s2m or the deletion of the nucleotides corresponding to s2m impacted viral replication in vitro. In vitro passaging of the recombinant IBV with the s2m sequence deleted resulted in a 36-nucleotide insertion in place of the deletion, which was identified to be composed of a duplication of flanking sequences. A similar result was observed following serial passage of human astrovirus with a deleted s2m sequence. RNA modeling indicated that deletion of the nucleotides corresponding to the s2m impacted other RNA structures present in the IBV 3' UTR. Our results indicated for both IBV and human astrovirus a preference for nucleotide occupation in the genome location corresponding to the s2m, which is independent of the specific s2m sequence. IMPORTANCE Coronaviruses infect many species, including humans and animals, with substantial effects on livestock, particularly with respect to poultry. The coronavirus RNA genome consists of structural elements involved in viral replication whose roles are poorly understood. We investigated the requirement of the RNA structural element s2m in the replication of the Gammacoronavirus infectious bronchitis virus, an economically important viral pathogen of poultry. Using reverse genetics to generate recombinant IBVs with either a disrupted or deleted s2m, we showed that the s2m is not required for viral replication in cell culture; however, replication is decreased in tracheal tissue, suggesting a role for the s2m in the natural host. Passaging of these viruses as well as human astrovirus lacking the s2m sequence demonstrated a preference for nucleotide occupation, independent of the s2m sequence. RNA modeling suggested deletion of the s2m may negatively impact other essential RNA structures.

A Novel Deletion in FERMT3 Causes LAD-III in a Turkish Family.

Leukocyte adhesion deficiency-III (LAD-III) is an extremely rare autosomal recessive syndrome caused by mutations in FERMT3, the gene encoding kindlin-3. The genetic alterations in this gene lead to abnormal expression or activity of kindlin-3 in leukocytes and platelets. Kindlin-3 acts as an important regulator of integrin activation. LAD-III has features of the bleeding syndrome of Glanzmann and also of leukocyte adhesion deficiency. In this study, we report on two families, one of Turkish and one of Syrian origin, with clinical features of LAD-III, loss of kindlin-3 protein expression, and a functional leukocyte defect. A novel, homozygous deletion in FERMT3 (c.921delC, p.Ser307Argfs*21) was found in the Turkish patient. The parents were carriers of the mutation, consistent with an autosomal recessive inheritance. A common c.1525C > T (p.Arg509*) mutation was found in the Syrian patient. In conclusion, beside the variant c.1525C > T in the FERMT3 gene, which was previously found in more than 15 patients in Anatolia, our study is the first to identify the novel homozygous variant c.921delC in the FERMT3 gene.

Identification of a novel 107 kb deletion in the alpha-globin gene cluster using third-generation sequencing.

OBJECTIVE: To describe the characterization of a novel deletion causing α-thalassemia. METHODS: The proband, a 30-year-old female, displayed mild anemia from thalassemia screening. Gap-PCR was used to detect the four common deletional α-thalassemia, and a PCR-reverse dot blot was performed for the three point mutations of the α-globin gene. Multiplex ligation-dependent probe amplification (MLPA) was used to query possible breakpoints of a potential novel deletion. Third-generation sequencing (TGS) was used to identify the novel deletion after the MLPA failed. Gap-PCR and Sanger sequencing were validated for the breakpoint. RESULTS: No abnormal results were detected by Gap-PCR and PCR-reverse dot blot. MLPA only showed a large deletion upstream of the HBZ-1 probe, but the scope could not be determined. However, a novel 107 kb deletion at the α-globin gene was discovered by the TGS. The Gap-PCR products with the specific breakpoint fragment of the 107 kb deletion were confirmed by Sanger sequencing. CONCLUSIONS: A 107 kb deletion causing α-thalassemia was the first reported worldwide. TGS played an important role in this study and can be recommended as a reliable tool for rare or potential deletions in thalassemia.

Four Turkish families with hyperekplexia: A missense mutation and the exon 1-7 deletion in the GLRA1 gene.

BACKGROUND: Hyperekplexia is a disease that progresses with excessive startle attacks and is included in the differential diagnosis of epilepsy and many movement disorders. METHODS: The WES results were validated in available family members by Sanger sequencing, or in the case of deletion, PCR followed by agarose gel electrophoresis was performed. RESULTS: WES analysis revealed the previously reported homozygous c.277C>T p.Arg93Trp variant in the GLRA1 gene (ENST00000455880.2) in Family 1. In all other three families, the previously reported homozygous deletion of exons 1-7 of the GLRA1 gene was identified using CNV analysis based on the WES data. CONCLUSIONS: The homozygous exon1-7 deletion has been described several times in different populations and may be a founder mutation in the Kurdish people in Turkey. The family with Arg93Trp variant stems from the Black Sea region of Turkey where close consanguinity is common. These analyses are important to provide genetic counseling to families and for a better understanding of the pathophysiology of the disease.

An exonuclease III-amplified 4-way strand migration system for low-abundance deletion mutation.

A 4-way strand exchange competitive DNA testing system based on Holliday junction has an advantage in realizing high sensitivity and specificity simultaneously. However, the kinetics is limited without enzyme assisting. Herein, we constructed a method that combined a 4-way strand migration system and exonuclease III (Exo III). For the properties of Exo III that has high catalytic effects and no specific recognition site, a DNA probe assisted by Exo III is easy to design and synthesize. We applied the system to detect different lengths of deletion mutation, and the results showed that the time to differentiate wild-type DNA and mutant-type DNA was so short within 5-20 min. Besides, the discrimination factor (DF) was as high as 1177.88 for EGFR-15-nt deletion, and the mutation detection limit was as low as 0.02% for PBRM1-8-nt deletion. Without adding any other specific label, the Exo III-amplified 4-way strand migration system is a simple, sensitive, selective, and cost-effective method that suggests a potential possibility for the diagnosis of cancers.

A novel large in-frame FBN1 deletion causes neonatal Marfan syndrome.

Neonatal Marfan syndrome (nMFS) is a rare and severe form of Marfan syndrome (MFS) with a poor prognosis, that presents with a highly variable phenotype, particularly regarding skeletal, ocular, and cardiovascular manifestations. Mutations in the fibrillin-1 (FBN1) gene are known as the principal cause of MFS and MFS-related syndromes. Here, we report on a full-term female neonate with postnatal characteristics suggestive of nMFS, including severe cardiovascular disease resulting in cardiorespiratory failure and death by 4 mo of age. We identified a novel large genomic in-frame deletion of FBN1 exons 42-45, c.(5065 + 1_5066 - 1)_(5545 + 1_5546 - 1)del. Large FBN1 in-frame deletions between exons 24 and 53 have been associated with severe MFS. The deletion in our patient differs from the FBN1 region associated with the majority of nMFS cases, exons 24-32.

DEFB126 polymorphisms and association with idiopathic asthenozoospermia in China.

Idiopathic asthenozoospermia, a common factor in male infertility, is characterized by altered sperm motility function in fresh ejaculate. Although the ß-defensin 126 (DEFB126) protein is associated with asthenozoospermia, DEFB126 gene polymorphisms have not been extensively studied. Therefore, the association between DEFB126 gene polymorphisms and asthenozoospermia requires further investigation. Screening was performed by semen analysis, karyotype analysis, and Y microdeletion detection, and 102 fertile men and 106 men with asthenozoospermia in Chengdu, China, were selected for DEFB126 gene sequence analyses. Seven nucleotide mutations and two nucleotide deletions in the DEFB126 gene were detected. rs11467417 (317-318 del/del), rs11467497 (163-166 wt/del), c.152T>C, and c.227A>G were significantly different between the control and asthenozoospermia groups, likely representing high-risk genetic factors for asthenozoospermia among males. DEFB126 expression was not observed in sperm with rs11467497 homozygous deletion and was unstable in sperm with rs11467417 homozygous deletion. The rs11467497 four-nucleotide deletion leads to truncation of DEFB126 at the carboxy-terminus, and the rs11467417 binucleotide deletion produces a non-stop messenger RNA (mRNA). The above deletions may be responsible for male hypofertility and infertility by reducing DEFB126 affinity to sperm surfaces. Based on in silico analysis, the amino acids 51M and 76K are located in the highly conserved domain; c.152T>C (M51T) and c.227A>G (K76R) are predicted to be damaging and capable of changing alternative splice, structural and posttranslational modification sites of the RNA, as well as the secondary structure, structural stability, and hydrophobicity of the protein, suggesting that these mutations are associated with asthenozoospermia.